Problem Set # 2

PHR 647

 


1. Indicate the type of library(ies) you would choose to screen if you wanted to isolate: 

a) promoter sequences which regulate a gene? 


b) coding sequences for a protein? 


c) 3' untranslated regulatory sequences for mRNA stability (3' NTE)? 


d) intron sequences? 



2. A researcher wants to test a specific gene for changes in gene expression in response to a drug treatment. The laboratory routinely uses such techniques as Northern
analysis, PCR, cloning of hybrid constructs, transient transfections of cell cultures, and solution hybridization. Which of these techniques would be used to: 

a) determine the size of the message? 


b) quantitate changes in levels of the rare message? 


c) if the drug alters transcription, identify the cis-acting element responsible for the regulation? 



3. Design an oligonucleotide probe to quantitate the following mRNA (cDNA sequence below) by solution hybridization at 55 C, given that the probe should be at least
20 bp and have a Tm 25 degrees above the hybridizaiton temperature. 

5' ATACGGCAAATGCCAACAAAGGAGAAGAGAGTGGACCCTGAATGACAAAAAAA 3'


The mRNA sequence represents the coding or sense strand sequence (top). The probe sequence represents the complementary noncoding or antisense strand sequence
(bottom). 

How would you radiolabel the oligonucleotide probe? 


What would you use for a standard curve? 



4. How many fragments will be detected after S1 nuclease digestion of the following hybrids: 

a) a kinase-labeled probe containing exon a, intron 1, exon b and a full length mRNA with 9 exons (exons a-i)? 


b) the same probe and mRNA as above, where the probe has been internally labeled by random priming?