|
1. Indicate the type of library(ies) you would choose to screen if you wanted to isolate:
a) promoter sequences which regulate a gene?
Genomic
b) coding sequences for a protein?
cDNA is first choice; genomic clones would also contain exonic sequences.
c) 3' untranslated regulatory sequences for mRNA stability (3' NTE)?
same as for b.
d) intron sequences?
Genomic
2. A researcher wants to test a specific gene for changes in gene expression in response to a drug treatment. The laboratory routinely uses such techniques as Northern
analysis, PCR, cloning of hybrid constructs, transient transfections of cell cultures, and solution hybridization. Which of these techniques would be used to:
a) determine the size of the message?
Northern hybridization.
b) quantitate changes in levels of the rare message?
Solution hybridization (S1 nuclease or RPA). Quantitative RT-PCR could also be used if the message was undetectable by solution hybridization.
c) if the drug alters transcription, identify the cis-acting element responsible for the regulation?
Transient expression analysis of hybrid constructs containing promoter sequences and reporter cDNA sequences.
3. Design an oligonucleotide probe to quantitate the following mRNA (cDNA sequence below) by solution hybridization at 55 C, given that the probe should be at least
20 bp and have a Tm 25 degrees above the hybridizaiton temperature.
5' ATACGGCAAATGCCAACAAAGGAGAAGAGAGTGGACCCTGAATGACAAAAAAA 3'
example: 3' TACGGTTGTTTCCTCTTCTCTCACCT 5' 26 nucleotides, Tm = 76C
The mRNA sequence represents the coding or sense strand sequence (top). The probe sequence represents the complementary noncoding or antisense strand sequence
(bottom).
How would you radiolabel the oligonucleotide probe?
Using T4 kinase and gamma ATP to label the 5' end.
What would you use for a standard curve?
A 26 base oligonucleotide representing the actual mRNA sequence from the coding or sense strand which is complementary to the probe.
4. How many fragments will be detected after S1 nuclease digestion of the following hybrids:
a) a kinase-labeled probe containing exon a, intron 1, exon b and a full length mRNA with 9 exons (exons a-i)?
Exons a and b are protected; exons c - i are single-stranded and degraded; intron 1 in the probe does not have complementary sequences in the mRNA and is degraded.
The probe is labeled at the 5' end only (exon b) and thus, only one fragment will be seen on the gel.
b) the same probe and mRNA as above, where the probe has been internally labeled by random priming?
Exons a and b will both be protected and radiolabeled and thus, two fragments will be seen.
|